Skip to content

nrminor/genotype

Repository files navigation

GenoType

CI Build Native Docs Build Status Docs Site TypeScript Bun v1.2.21 Rust Nightly WebAssembly License

Caution

GenoType is coming together but is not ready for the bigtime yet. Recently, it's gone through a rapid period of growth, with new features including much more SIMD, Rust-backed BAM parsing, a ground-up restructuring of I/O and backend integration with Effect v4, and browser support via WebAssembly. While the central sequence operations (SeqOps) API is comparatively stable, breaking changes should be expected as the rule, not the exception--this is pre-alpha software.

GenoType's Goal

GenoType's goal is to fill a gap in the TypeScript ecosystem by providing a fully type-safe, performant, idiomatic library for parsing and processing genomic data in any of the major bioinformatic data formats. It's built with an obsession with developer experience and enables users to compose their own pipelines of sequence transformations in a fluent DSL. For example, the following "pipeline", mirroring a Unix pipeline of operations from the excellent Seqkit command line interface, can be composed in TypeScript like so:

import { seqops } from "genotype";

const results = await seqops(genomeSequences)
  .grep({ pattern: /^chr\d+/, target: "id" }) // Find chromosome sequences
  .filter({ minLength: 100, maxGC: 60 }) // Quality filtering
  .sample({ n: 1000, strategy: "reservoir" }) // Statistical sampling
  .sort({ by: "length", order: "desc" }) // Compression-optimized sorting
  .rmdup({ by: "sequence", caseSensitive: false }) // Remove duplicates
  .writeFasta("analyzed_genome.fasta");

A majority of features provided in SeqKit will also be provided by GenoType, plus some extra goodies that make sense in the context of a TypeScript library (e.g., K-mer set algebra or higher-order function combinators).

Fast internals

Where possible, GenoType delegates sequence operations to SIMD accelerated kernels implemented in Rust. These optimizations, together with the overall speed of modern JavaScript runtimes, make GenoType's performance competitive with if not better than SeqKit, which is implemented in Go and was one of the inspirations behind GenoType's DSL (benchmarks coming soon!). Additionally, Rust compiles both to native extensions as well as WebAssembly modules, which means GenoType's SIMD kernels can run on the server, in the browser, or anywhere in between.

Runtime-Agnostic Architecture

GenoType uses Effect as its internal standard library for file I/O, management of our native/WASM engine kernels, runtime control like interruption, and platform-specific operations. This architectural choice makes GenoType runtime-agnostic, running equivalently in Node.js, Bun, Deno, and the browser.

Portable Scripting

GenoType was designed with scripting in mind. As of 2026, the story for scripting in JavaScript and TypeScript is exceptionally good, a fact that is underappreciated in data science and bioinformatics. Runtimes like Bun and Deno can run standalone scripts, handling inline dependencies by default like how the Python manager uv can handle Python dependencies--no need for virtual environments and dependency hell. Unlike Python scripts, Bun and Deno scripts also benefit from years of JavaScript runtime optimization. Most remarkably, Bun and Deno don't even require that the runtimes themselves are installed. Both runtimes can compile scripts into portable standalone executables for most popular OS/CPU architecture targets, with ease of cross-compilation to rival Go or Zig.

Overall

Be it for the bioinformatics in the browser, portable scripting, or backend data crunching, GenoType's goal is to enable users to write intricate, high-throughput pipelines of genomic data transformations and run them anywhere. Providing a composable, type-safe DSL for building portable, dependency-free bioinformatic processing programs is what GenoType is all about.

Installation

Warning

GenoType is not available on NPM yet, so the following will not work. Instead, if you're using bun, you can add it from source (again, at your own risk) into your own project with bun add github:nrminor/genotype.

bun add @nrminor/genotype

Real-World Examples

Quality Control Pipeline

Problem: You've received Illumina sequencing data from a collaborator. As always, it needs quality control before analysis.

import { seqops, FastqParser } from "genotype";

// Parse FASTQ with quality encoding specification (or automatic detection)
const parser = new FastqParser({
  qualityEncoding: "phred33", // Specify encoding, or omit for automatic detection
  parseQualityScores: true, // Enable quality score parsing for QC
});
const reads = parser.parseFile("SRR12345678.fastq.gz");

// Build a comprehensive QC pipeline
const qcStats = await seqops(reads)
  // Step 1: Quality filtering
  .quality({
    minScore: 20, // Phred score threshold
    trim: true, // Enable quality trimming
    trimThreshold: 20, // Sliding window quality
    trimWindow: 4, // Window size
  })
  // Step 2: Length filtering (post-trimming)
  .filter({
    minLength: 35, // Minimum read length
    maxLength: 151, // Remove anomalously long reads
  })
  // Step 3: Contamination screening
  .filter({
    pattern: /^[ACGTN]+$/, // Valid bases only
    hasAmbiguous: false, // No ambiguous bases
  })
  // Step 4: Calculate statistics
  .stats({ detailed: true });

console.log(`
QC Report:
- Sequences: ${qcStats.numSequences}
- Total length: ${qcStats.totalLength}
- Mean quality: ${qcStats.qualityStats?.meanQuality?.toFixed(1) ?? "N/A"}
- N50: ${qcStats.n50}
- GC content: ${((qcStats.gcContent ?? 0) * 100).toFixed(1)}%
`);

Amplicon Extraction for Targeted Sequencing

Problem: You need to extract specific amplicon regions from sequencing data using PCR primers, with support for long reads and biological validation.

import { FastqParser, primer, seqops } from "genotype";

// Define primers with compile-time validation and IUPAC support
const forwardPrimer = primer.literal("TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG"); // Nextera adapter
const reversePrimer = primer.literal("GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG"); // Nextera adapter

// Simple amplicon extraction (90% use case)
const basicAmplicons = await seqops(reads)
  .amplicon(forwardPrimer, reversePrimer) // Extract between primers
  .filter({ minLength: 100, maxLength: 500 }) // Quality filtering
  .writeFasta("extracted_amplicons.fasta");

// Advanced workflow with performance optimization for long reads
const optimizedAmplicons = await seqops(nanoporeReads)
  .quality({ minScore: 10 }) // Nanopore quality threshold
  .amplicon(forwardPrimer, reversePrimer, {
    maxMismatches: 2, // Allow sequencing errors
    searchWindow: { forward: 200, reverse: 200 }, // 🔥 100x+ speedup for long reads
    flanking: false, // Inner region only (exclude primers)
    outputMismatches: true, // Include debugging info
  })
  .filter({ minLength: 200, maxLength: 800 }) // Target region length
  .rmdup("sequence") // Remove PCR duplicates
  .validate({ mode: "strict" }) // Biological validation
  .writeFasta("validated_amplicons.fasta");

// Real-world COVID-19 diagnostic example
const covidResults = await seqops(new FastqParser().parseFile("covid_samples.fastq.gz"))
  .quality({ minScore: 20, trim: true })
  .amplicon(
    primer.literal("ACCAGGAACTAATCAGACAAG"), // N gene forward
    primer.literal("CAAAGACCAATCCTACCATGAG"), // N gene reverse
    3 // Allow for sequencing errors
  )
  .validate({ mode: "strict" })
  .stats({ detailed: true });

console.log(`Found ${covidResults.numSequences} COVID amplicons`);

CRISPR Guide RNA Design

Problem: You need to design guide RNAs for CRISPR, filtering for optimal GC content and checking for off-target sites.

const potentialGuides = await seqops(sequences)
  // Extract all possible 20bp guide sequences
  .transform({
    custom: (seq) => extractKmers(seq, 20),
  })

  // Filter for optimal guide characteristics
  .filter({
    minGC: 40, // Minimum 40% GC
    maxGC: 60, // Maximum 60% GC
    pattern: /GG$/, // Must end with PAM-adjacent GG
  })

  // Remove guides with problematic sequences
  .filter({
    custom: (guide) => {
      // No poly-T (terminates RNA pol III)
      if (/TTTT/.test(guide.sequence)) return false;

      // No extreme secondary structure
      const mfe = calculateMFE(guide.sequence);
      if (mfe < -10) return false;

      return true;
    },
  })

  // Check for off-targets in genome
  .filter({
    custom: async (guide) => {
      const offTargets = await searchGenome(guide.sequence, { maxMismatches: 3 });
      return offTargets.length === 1; // Only one perfect match
    },
  })

  .collect();

console.log(`Found ${potentialGuides.length} suitable guide RNAs`);

Differential Expression Sample Prep

Problem: RNA-seq data needs preprocessing before differential expression analysis.

const processedReads = await seqops(rnaseqReads)
  // Remove adapter sequences
  .clean({
    removeAdapters: true,
    adapters: ["AGATCGGAAGAGC", "AATGATACGGCGAC"],
  })
  // Filter rRNA contamination (using bloom filter for speed)
  .filter({
    custom: (seq) => !rRNABloomFilter.contains(seq.sequence),
  })
  // Remove low-complexity sequences
  .filter({
    custom: (seq) => calculateComplexity(seq.sequence) > 0.5,
  })
  // Remove duplicates
  .rmdup("sequence")
  // Convert to format for aligner
  .transform({ upperCase: true })
  .writeFastq("processed_rnaseq.fastq");

Viral Genome Assembly QC

Problem: Validate assembled viral genomes before submission to GenBank.

const validationReport = await seqops(assemblies)
  // Check genome completeness
  .filter({
    minLength: 29000, // SARS-CoV-2 minimum
    maxLength: 30000, // SARS-CoV-2 maximum
  })
  // Validate sequence content
  .validate({
    mode: "strict",
    allowAmbiguous: true, // Some Ns acceptable
    maxAmbiguous: 100, // But not too many
    action: "reject", // Reject invalid sequences
  })
  // Check for frameshifts in coding regions
  .validate({
    custom: async (seq) => {
      const orfs = await findORFs(seq.sequence);
      return orfs.every((orf) => orf.length % 3 === 0);
    },
  })
  .stats({ detailed: true });

console.log(`Validated ${validationReport.numSequences} genomes`);
console.log(
  `N50: ${validationReport.n50}, GC: ${((validationReport.gcContent ?? 0) * 100).toFixed(1)}%`
);

About

Type-Safe Bioinformatics in TypeScript (WIP!)

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Contributors